|
Article Excerpt SOYBEAN OIL is a mixture of five fatty acids (palmitic, stearic, oleic, linoleic, and linolenic) that differ greatly m melting points, oxidative stabilities, and chemical functionalities (Cahoon, 2003). Although seed fatty acid composition is controlled by quantitative genetic traits, current research also includes a strong focus on the contribution and manipulation of fatty acid desaturase genes. The goal of efficiently altering fatty acid composition to meet the specific needs of industry therefore requires the efforts of soybean breeders and molecular geneticists.
Increasing the stearic acid content of soybean oil is desirable for certain food-processing applications since increased stearic acid content offers the potential for the production of solid fat products without hydrogenation (Spencer et al., 2003). This would reduce the content of transfat in food products and reduce a current health concern. High stearic acid oil could also be used as a replacement for tropical oils that are also high in palmitic acid, which poses a heart disease risk.
Stearic acid concentration in soybean is genetically determined by alterations at the Fas locus. In addition to FAM94-41 (Pantalone et al., 2002), a high stearic acid line carrying a natural mutation (fasnc), five other soybean germplasm lines have been reported to carry mutated stearic acid alleles that increase stearic acid: A6, [fas.sup.a] (Hammond and Fehr, 1983); FA41545, [fas.sup.b] (Graef et al., 1985a); A81-606085, fas (Graef et al., 1985b); KK-2, [st.sub.1] (Rahman et al., 1997); and M25, [st.sub.2] (Rahman et al., 1997). Fasa (30% stearic acid),fasb (15% stearic acid), and fas (19% stearic acid) are allelic and represent different mutations in the same gene (Burton et al., 2004; Spencer et al., 2003). One candidate gene, although unproven, for the Fas locus in soybean, is the [DELTA]9 stearoyl-acyl carrier protein (ACP) desaturase (Wilson, 2004). The [DELTA]9 stearoyl-ACP desaturase enzyme (SACPD), through the insertion of a double bond at [C.sub.9], converts stearic to oleic acid. Thus, SACPD occupies a key position in C18 fatty acid biosynthesis since perturbation of SACPD gene expression and/or enzyme activity may modulate the relative level of both stearic and oleic acid in soybean oil. Down-regulated SACPD expression or enzyme activity could produce oil with greater stearic acid, while increased expression of SACPD or enzyme activity could produce oil with greater oleic acid content.
In this study, we determined that there are two SACPD genes in soybean, a situation not previously recognized. The objective of this research was to characterize SACPD gene structure, determine the distribution of the SACPD genes in Glycine, and analyze SACPD expression levels in stages of seed development.
MATERIALS AND METHODS
Amplification, Cloning, and Sequencing
Genomic DNA was prepared form liquid nitrogen-frozen, powdered soybean leaves with the DNeasy Plant Mini kit from Qiagen (Valencia, CA) following manufacturer's protocol. Soybean leaves were harvested from 5-wk-old greenhouse grown plants. DNA samples were resuspended in sterile water. Soybean genomic SACPDs were amplified with oligonucleotide primers 5'GCGCCTTACATCACATAC 3'-forward and 5'GCTGCCCCTAACTGC 3'-reverse that were based on the GenBank mRNA sequence (accession number L34346) for a Glycine max, soluble stearoyl-acyl carrier protein desaturase (SACPD). In other experiments, SACPD exons 2 and exons 3 were amplified. Primers for exon 2 amplification were 5'CATCCTTACCCTATACCTG3'-forward and 5'CTACCATTGCGGAAGACC3'-reverse. Primers for exon 3 were 5'GATTCTTCATAGCTGCTGC3'-forward and 5'GCTGCCCCTAACTGC3'-reverse. Amplification reactions (25 [micro]L) contained 50 ng genomic DNA, 250 nM each primer, 2.5 [micro]M each dNTP, 1 unit Taq DNA polymerase (Fisher, Atlanta, GA), and 1 x PCR buffer [300 mM Tris-HCL, 75 mM [(N[H.sub.4]).sub.2]S[O.sub.4], 7.5 mM Mg[Cl.sub.2], pH 8.5]. Reaction conditions were 94[degrees]C for 2 min (1 cycle), then 94[degrees]C for 1 min, 55[degrees]C for 2 rain, 72[degrees]C for 3 min (30 cycles), then 72[degrees]C for 7 min.
Primers were also designed to a region of variability in exon 3 of SACPD. PCR with these primers produced products that discriminated between SACPD gene A (133 bp) and gene B (111 bp). These gene-specific primers were used to type soybean cultivars as well as to quantify steady state mRNA accumulation by real-time RT-PCR. Gene-specific primers for SACPD-A (primer set A) were 5'CCTGTTTGATAACTACTCTGCC3'-forward and 5'TCTTCCCTCACCTGAAAGTCCG3'-reverse. Gene-specific primers for SACPD-B (primer set B) were 5'CCTGTTTGATAGCTACTCTTCG3'-forward and 5' GTTAGCTGCTCCACCTCC3'-reverse. Primers for the soybean housekeeping gene actin were 5'GAGCTATGAATTGCCTGATGG3' forward and 5'CGTITCATGAATTCCAGTAGC3' reverse derived from GenBank accession number U60500 (Moniz de Sa and Drouin 1996). Amplification of actin was done according to the protocol outlined above for...
|